Mods / Regular ModuleKeep Talking and Nobody Explodes mods
Keep Talking and Nobody Explodes regular module mods
Everything filed under regular module by its own author, ordered by how much it is used.
1.9k regular module mods
- Sporadic Segmentsby asreissThis appears to be a cross between a GameBoy and a digital clock, except the GameBoy only has one game, and the clock... Sporadic Segments module by PANOPTES version 1.00. Font is Clandesdyne Pixelated Digital Clock, by Clandesdyne. Module ID: xelSporadicSegments Github Repo:1.9k downloadsupdated 4 y ago
- Accelerandoby TimwiThis is a re-upload of Goofy’s module. Please unsubscribe from the old version. Keep track of an accelerating sequence of number-letter pairs and press the correct letters. Includes rule-seed support and TP support.1.9k downloadsupdated 11 mo ago
- Hold Onby 76561198928399095Using edgework, find the number of seconds the on button must be held for. Module ID: ashHoldOn1.9k downloadsupdated 5 y ago
- The Logan Parody Jukeboxby 76561198419068972Logan (aka "wow its a person") sings his own parodies some of your favorite songs in this spin-off of The Jukebox!1.8k downloadsupdated 5 y ago
- Sysadminby NickLatkovichA module in which you need to administer the network through the console.1.8k downloadsupdated 5 y ago
- Simon Swindlesby 76561199013569552Kick player: Simon (Cheating) Press F1 to vote YES Press F2 to vote NO Vote Count: YES-8 NO-1 Module ID: simonSwindles Manual can be found at:1.8k downloadsupdated 4 y ago
- Cruelloby SpeakingevilCruello ver 1.0 Easy as... ...it's not easy. Toggle the buttons in the grid such that the numbers in each row and column add up to the desired values and their colours follow certain rules. Created by Speakingevil1.8k downloadsupdated 6 y ago
- Snack Attackby 76561198379883337"Experimental gameplay is in command. Also, food is in stock." Idea/Implementer - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 4 y ago
- Next In Lineby Fartlicker777Unlike elementary school, cutting in line is allowed. Cut a wire based on the previously cut wire. Module design by eXish. Manual can be found at ktane.timwi.de If there are any bugs, contact Fartlicker777 on Discord.1.8k downloadsupdated 5 y ago
- RGB Hypermazeby okPerform rotations on a 4D maze generated by boolean operations.1.8k downloadsupdated 3 y ago
- Icon Revealby 76561198419068972Figure out what the icon is and its periodic table symbol! (Note: The icon does not actually get "revealed" over time, it's just static.) This module may encounter frequent bugs so please contact me with a logfile if this occurs.1.8k downloadsupdated 6 y ago
- Cursor Mazeby eXishNavigate your cursor through a simple maze without touching the walls. This module requires a mouse to be solved. HTML: PDF: Cursor Maze (cursorMazeModule) v1.0.4 Module and Concept by eXish Twitch Plays supported1.8k downloadsupdated 3 y ago
- Keypad Directionalityby 76561198379883337"Am I actually going anywhere with these arrows?" Idea - DragonManiac Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 5 y ago
- Flyswattingby 76561198443052403Damn. I thought humanity was getting better but now they decided to put the most annoying activity that has ever existed on this Earth on a $%^&ing bomb... Module ID: flyswatting The manual can be found here:1.8k downloadsupdated 2 y ago
- Red Herring (REUPLOAD)by tandyCakeRed Herring: Noun, something to distract you from the task at hand. Module originally by Deaf Reuploaded and reworked by tandyCake moduleID: RedHerring Manual can be found at ktane.timwi.de1.8k downloadsupdated 5 y ago
- Stacked Sequencesby 76561198873224404ere do I start? Where do I start? Where do I start? Where do I sta A collaboration with GhostSalt#0217 on Discord where we reversed roles compared to The Xenocryst.1.8k downloadsupdated 6 y ago
- GoodHood's Modulesby 76561198343303283All four of GoodHood's now-deleted modules, reuploaded (technically). Includes: Press The Shape Standard Button Masher Button Order Binary Buttons1.8k downloadsupdated 5 y ago
- Drive-In Windowby Grenade JumperI'll have a burger, a shake, and a live bomb, please. My first module, inspired by seeing in chat one day, as well as this being my favorite esolang. Direct any bug reports or suggestions to Norville Rogers#1633 on Discord. As this is my first mod, any feedback is nice. Has TP Support.1.8k downloadsupdated 3 y ago
- DNA Mutationby 76561198379883337"GATCGATTCGATCGATGCTAGC…" Idea - Serum Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 5 y ago
- Colored Lettersby 76561198379883337"Multicolored multialphabet multibutton." Idea - Pruz Original Implementer - Panoptes Current Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 4 y ago
- Supermassive Black Holeby NickLatkovichThrow a sequence of base-36 digits into a supermassive black hole based on its accretion disk. Supermassive Black Hole has integration with regular Black Hole. Rule Seed: Supported (code synced with rule seed of regular Black Hole); Twitch Plays: Supported1.8k downloadsupdated 5 y ago
- Frankenstein's Indicatorby 76561198443052403THE INDICATOR IS ALIVE!!! Bad news: It morphed into a module. Module ID: frankensteinsIndicator The manual can be found here:1.8k downloadsupdated 3 y ago
- Stable Time Signaturesby Fartlicker777A practice variant of Time Signatures that doesn't reset upon listening to it again! Original module by KingBranBran which can be found at Also thanks to KingBranBran for allowing me to do this. If you want to set how many time signatures to do in a mission, put the following in the description:...1.8k downloadsupdated 21 mo ago
- Iñupiaq Numeralsby 76561198443052403If you’re complaining about the fact that this has an ñ in it’s name, just be glad it’s not an ŋ, nobody knows how to pronounce that. Module ID: inupiaqNumerals The manual can be found here:1.8k downloadsupdated 8 mo ago
- Lights Onby SpeakingevilLights On ver 1.0 Commence confused random mashing of buttons Activate only the green lights where toggling any light toggles the lights adjacent to it Created by Speakingevil1.8k downloadsupdated 4 y ago
- Stoichiometryby Hot Rock SoupNeutralize two acids and account for their reactions by calculating salts and possible gas byproducts.1.8k downloadsupdated 5 y ago
- Fractal Modulesby 76561198873224404Welcome to the world of infinity!1.8k downloadsupdated 4 y ago
- Hole in Oneby 76561198379883337"Why are sports becoming modules now?" (Re)Implementer - BigCrunch22 Recreation of the removed module created by Finder TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 3 y ago
- Blue Whaleby 76561198343303283Alan Davies approves of this module1.8k downloadsupdated 5 y ago
- Mischmodulby tandyCakeThe Germans were particularly fond of jigsaw puzzles. Module created by tandyCake moduleID: mischmodul Manual can be found on ktane.timwi.de1.8k downloadsupdated 4 y ago
- nya~by 765611984190689721.8k downloadsupdated 6 y ago
- Striped Keysby xXTheDweebXxStriped Keys - V1.1 "So many colors." Module ID: kataStripedKeys Module Idea created by: Pruz Module Implemented by: Katarina TP-Supported. HTML Manual Version: If there are any problems that you may have, contact me via Discord: Smexy Ahri#52591.8k downloadsupdated 6 y ago
- OmegaDestroyerby mythers45oh my. Manual: PDF:1.8k downloadsupdated 6 y ago
- The Close Buttonby 76561198379883337"Popup ads have stepped up their game. Bring it on" Idea/Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 5 y ago
- Solitaire Cipherby Sean1.8k downloadsupdated 3 y ago
- Tribal Councilby 7656119900312773339 days...20 people...who will be voted out tonight???? Will it be you??? Contact ManiaMate#8776 to report any bugs with the module.1.8k downloadsupdated 6 y ago
- Outrageousby 76561198443052403I don’t think words can explain what the hell happened at the factory. Module ID: outrageous The manual can be found here:1.8k downloadsupdated 8 mo ago
- Purchasing Propertiesby The-nth-TermA KTANE mod based on the classic board game Monopoly. Written by The-nth-Term With help from Flamanis Published for KTaNE Modding Jam #1 on July 5, 2021. Manual here:1.8k downloadsupdated 5 y ago
- Encrypted Hangmanby eXishThis is a reupload of a module, unsubscribe from the old version here: Play a game of Hangman! HTML: PDF: Encrypted Hangman (encryptedHangman) v1.2.2 Module by GeekYiwen, maintained by eXish Twitch Plays supported1.8k downloadsupdated 4 y ago
- Pixel Number Baseby 76561198379883337"No. Just no." Idea/(Re)Implementer - BigCrunch22 The ownership of the module has been transferred to me. Unsubscribe from the older version: TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 6 y ago
- Shut-the-Boxby 76561198419068972Flip tiles that add up to the sums of your dice rolls.1.8k downloadsupdated 5 y ago
- hexVariantsby HexylOn the Subject of hexVariants "Funding for these programs was made possible by the Keep Coding Library, and by annual moral support from viewers like you." ------------------------------------------------------------------------------------------------------ Refer to this link to see everything/e...1.8k downloadsupdated 5 y ago
- Simply Simonby 76561199013569552Just press the flash™ ModuleId: simplysimon1.8k downloadsupdated 4 y ago
- Polygridby SpeakingevilPolygrid ver 1.0 Once again, your life depends on your ability to solve a casual puzzle. Place the displayed rows and columns into the grid such that the overlapping shapes are the same. Created by Speakingevil1.8k downloadsupdated 4 y ago
- Keypad Mazeby JeSuisFunEtHDSubmit a 4-digit code based on the maze you are in. Manual can be found in: ktane.timwi.de Reserve manual: Module id: KeypadMaze1.8k downloadsupdated 3 y ago
- eeB gnillepSby SpeakingevileeB gnillepS ver 1.0 Turn me on, dead man. Identify the word spoken in a reversed audio clip and spell it backwards. Created by Speakingevil Based on Spelling Bee by Blananas2 & Asew543211.8k downloadsupdated 6 y ago
- Subwayby Grenade JumperListen to Face Jam. Module ID: subway Manual:1.8k downloadsupdated 2 mo ago
- Dice Cipherby tandyCakeSome password generators use atmospheric noise to create their random passwords. This one uses a good ol’ fashioned roll of the dice. Module by tandyCake moduleID: diceCipher Manual can be found on ktane.timwi.de1.8k downloadsupdated 5 y ago