Mods / Regular Module

• SSporadic Segmentsby asreissThis appears to be a cross between a GameBoy and a digital clock, except the GameBoy only has one game, and the clock... Sporadic Segments module by PANOPTES version 1.00. Font is Clandesdyne Pixelated Digital Clock, by Clandesdyne. Module ID: xelSporadicSegments Github Repo:1.9k downloadsupdated 5 y ago
• HHold Onby 76561198928399095Using edgework, find the number of seconds the on button must be held for. Module ID: ashHoldOn1.9k downloadsupdated 5 y ago
• TThe Logan Parody Jukeboxby 76561198419068972Logan (aka "wow its a person") sings his own parodies some of your favorite songs in this spin-off of The Jukebox!1.9k downloadsupdated 5 y ago
• SSysadminby NickLatkovichA module in which you need to administer the network through the console.1.9k downloadsupdated 5 y ago
• SSimon Swindlesby 76561199013569552Kick player: Simon (Cheating) Press F1 to vote YES Press F2 to vote NO Vote Count: YES-8 NO-1 Module ID: simonSwindles Manual can be found at:1.9k downloadsupdated 4 y ago
• CCursor Mazeby eXishNavigate your cursor through a simple maze without touching the walls. This module requires a mouse to be solved. HTML: PDF: Cursor Maze (cursorMazeModule) v1.0.4 Module and Concept by eXish Twitch Plays supported1.9k downloadsupdated 3 y ago
• GGoodHood's Modulesby 76561198343303283All four of GoodHood's now-deleted modules, reuploaded (technically). Includes: Press The Shape Standard Button Masher Button Order Binary Buttons1.9k downloadsupdated 5 y ago
• CCruel Starsby CyberA less forgiving version of stars, play with caution. Manual:1.9k downloadsupdated 6 y ago
• IIcon Revealby 76561198419068972Figure out what the icon is and its periodic table symbol! (Note: The icon does not actually get "revealed" over time, it's just static.) This module may encounter frequent bugs so please contact me with a logfile if this occurs.1.9k downloadsupdated 6 y ago
• CCruelloby SpeakingevilCruello ver 1.0 Easy as... ...it's not easy. Toggle the buttons in the grid such that the numbers in each row and column add up to the desired values and their colours follow certain rules. Created by Speakingevil1.9k downloadsupdated 6 y ago
• NNext In Lineby Fartlicker777Unlike elementary school, cutting in line is allowed. Cut a wire based on the previously cut wire. Module design by eXish. Manual can be found at ktane.timwi.de If there are any bugs, contact Fartlicker777 on Discord.1.9k downloadsupdated 5 y ago
• RRGB Hypermazeby okPerform rotations on a 4D maze generated by boolean operations.1.9k downloadsupdated 3 y ago
• SSnack Attackby 76561198379883337"Experimental gameplay is in command. Also, food is in stock." Idea/Implementer - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 4 y ago
• KKeypad Directionalityby 76561198379883337"Am I actually going anywhere with these arrows?" Idea - DragonManiac Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 6 y ago
• FFlyswattingby 76561198443052403Damn. I thought humanity was getting better but now they decided to put the most annoying activity that has ever existed on this Earth on a $%^&ing bomb... Module ID: flyswatting The manual can be found here:1.9k downloadsupdated 2 y ago
• SSupermassive Black Holeby NickLatkovichThrow a sequence of base-36 digits into a supermassive black hole based on its accretion disk. Supermassive Black Hole has integration with regular Black Hole. Rule Seed: Supported (code synced with rule seed of regular Black Hole); Twitch Plays: Supported1.9k downloadsupdated 1 mo ago
• RRed Herring (REUPLOAD)by tandyCakeRed Herring: Noun, something to distract you from the task at hand. Module originally by Deaf Reuploaded and reworked by tandyCake moduleID: RedHerring Manual can be found at ktane.timwi.de1.9k downloadsupdated 5 y ago
• CColored Lettersby 76561198379883337"Multicolored multialphabet multibutton." Idea - Pruz Original Implementer - Panoptes Current Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 5 y ago
• DDNA Mutationby 76561198379883337"GATCGATTCGATCGATGCTAGC…" Idea - Serum Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 5 y ago
• DDrive-In Windowby Grenade JumperI'll have a burger, a shake, and a live bomb, please. My first module, inspired by seeing in chat one day, as well as this being my favorite esolang. Direct any bug reports or suggestions to Norville Rogers#1633 on Discord. As this is my first mod, any feedback is nice. Has TP Support.1.9k downloadsupdated 3 y ago
• SStacked Sequencesby 76561198873224404ere do I start? Where do I start? Where do I start? Where do I sta A collaboration with GhostSalt#0217 on Discord where we reversed roles compared to The Xenocryst.1.8k downloadsupdated 6 y ago
• FFrankenstein's Indicatorby 76561198443052403THE INDICATOR IS ALIVE!!! Bad news: It morphed into a module. Module ID: frankensteinsIndicator The manual can be found here:1.8k downloadsupdated 3 y ago
• SStable Time Signaturesby Fartlicker777A practice variant of Time Signatures that doesn't reset upon listening to it again! Original module by KingBranBran which can be found at Also thanks to KingBranBran for allowing me to do this. If you want to set how many time signatures to do in a mission, put the following in the description:...1.8k downloadsupdated 22 mo ago
• IIñupiaq Numeralsby 76561198443052403If you’re complaining about the fact that this has an ñ in it’s name, just be glad it’s not an ŋ, nobody knows how to pronounce that. Module ID: inupiaqNumerals The manual can be found here:1.8k downloadsupdated 9 mo ago
• LLights Onby SpeakingevilLights On ver 1.0 Commence confused random mashing of buttons Activate only the green lights where toggling any light toggles the lights adjacent to it Created by Speakingevil1.8k downloadsupdated 4 y ago
• FFractal Modulesby 76561198873224404Welcome to the world of infinity!1.8k downloadsupdated 4 y ago
• MMischmodulby tandyCakeThe Germans were particularly fond of jigsaw puzzles. Module created by tandyCake moduleID: mischmodul Manual can be found on ktane.timwi.de1.8k downloadsupdated 4 y ago
• BBlue Whaleby 76561198343303283Alan Davies approves of this module1.8k downloadsupdated 5 y ago
• EEncrypted Hangmanby eXishThis is a reupload of a module, unsubscribe from the old version here: Play a game of Hangman! HTML: PDF: Encrypted Hangman (encryptedHangman) v1.2.2 Module by GeekYiwen, maintained by eXish Twitch Plays supported1.8k downloadsupdated 4 y ago
• SStoichiometryby Hot Rock SoupNeutralize two acids and account for their reactions by calculating salts and possible gas byproducts.1.8k downloadsupdated 5 y ago
• Nnya~by 765611984190689721.8k downloadsupdated 6 y ago
• HHole in Oneby 76561198379883337"Why are sports becoming modules now?" (Re)Implementer - BigCrunch22 Recreation of the removed module created by Finder TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 3 y ago
• SStriped Keysby xXTheDweebXxStriped Keys - V1.1 "So many colors." Module ID: kataStripedKeys Module Idea created by: Pruz Module Implemented by: Katarina TP-Supported. HTML Manual Version: If there are any problems that you may have, contact me via Discord: Smexy Ahri#52591.8k downloadsupdated 6 y ago
• OOmegaDestroyerby mythers45oh my. Manual: PDF:1.8k downloadsupdated 6 y ago
• HhexVariantsby HexylOn the Subject of hexVariants "Funding for these programs was made possible by the Keep Coding Library, and by annual moral support from viewers like you." ------------------------------------------------------------------------------------------------------ Refer to this link to see everything/e...1.8k downloadsupdated 5 y ago
• TThe Close Buttonby 76561198379883337"Popup ads have stepped up their game. Bring it on" Idea/Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 5 y ago
• TTribal Councilby 7656119900312773339 days...20 people...who will be voted out tonight???? Will it be you??? Contact ManiaMate#8776 to report any bugs with the module.1.8k downloadsupdated 6 y ago
• PPurchasing Propertiesby The-nth-TermA KTANE mod based on the classic board game Monopoly. Written by The-nth-Term With help from Flamanis Published for KTaNE Modding Jam #1 on July 5, 2021. Manual here:1.8k downloadsupdated 5 y ago
• SSolitaire Cipherby Sean1.8k downloadsupdated 3 y ago
• OOutrageousby 76561198443052403I don’t think words can explain what the hell happened at the factory. Module ID: outrageous The manual can be found here:1.8k downloadsupdated 9 mo ago
• SShut-the-Boxby 76561198419068972Flip tiles that add up to the sums of your dice rolls.1.8k downloadsupdated 5 y ago
• PPixel Number Baseby 76561198379883337"No. Just no." Idea/(Re)Implementer - BigCrunch22 The ownership of the module has been transferred to me. Unsubscribe from the older version: TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 6 y ago
• SSimply Simonby 76561199013569552Just press the flash™ ModuleId: simplysimon1.8k downloadsupdated 4 y ago
• KKeypad Mazeby JeSuisFunEtHDSubmit a 4-digit code based on the maze you are in. Manual can be found in: ktane.timwi.de Reserve manual: Module id: KeypadMaze1.8k downloadsupdated 3 y ago
• PPolygridby SpeakingevilPolygrid ver 1.0 Once again, your life depends on your ability to solve a casual puzzle. Place the displayed rows and columns into the grid such that the overlapping shapes are the same. Created by Speakingevil1.8k downloadsupdated 4 y ago
• EeeB gnillepSby SpeakingevileeB gnillepS ver 1.0 Turn me on, dead man. Identify the word spoken in a reversed audio clip and spell it backwards. Created by Speakingevil Based on Spelling Bee by Blananas2 & Asew543211.8k downloadsupdated 6 y ago
• DDice Cipherby tandyCakeSome password generators use atmospheric noise to create their random passwords. This one uses a good ol’ fashioned roll of the dice. Module by tandyCake moduleID: diceCipher Manual can be found on ktane.timwi.de1.8k downloadsupdated 5 y ago
• SSubwayby Grenade JumperListen to Face Jam. Module ID: subway Manual:1.8k downloadsupdated 3 mo ago

1.9k regular module mods, most downloaded first. Each one has its own page here with what it needs to run and where its author publishes it; the files themselves stay with the author and are never re-hosted on this site.