Menu

mod

DNA Mutation

by 76561198379883337

"GATCGATTCGATCGATGCTAGC…" Idea - Serum Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.

Latest version
no release indexed
Downloads
1.8k
Rating
8
Filed under
Regular Module
Updated
5 y ago
Available on
Steam Workshop

Download

Delivered through the Steam client, not a file this page can link to.

Opens the Steam Workshop page. Steam adds it to your library from there.Subscribe on Steam Workshop

Frequently asked

How do I install DNA Mutation?

Install the matching loader first, then put the downloaded file in your mods folder and start the game. The loader, the mod and Keep Talking and Nobody Explodes all have to be on the same version, which is the usual reason a mod does not appear in game.

Where do I download DNA Mutation safely?

From the author's own page on Steam Workshop, which is where the data here is synced from. IndexGG never mirrors, re-hosts or repackages a file: every download button points at the original source, so you get exactly what the author published.

Which Keep Talking and Nobody Explodes versions does DNA Mutation work on?

The author has not declared a supported version in the metadata we sync, so there is nothing here we can state as fact. Check the project's own page before installing it, and treat an old mod with no declared version as untested on modern Keep Talking and Nobody Explodes.

Last checked 16 d ago against Steam Workshop. We do not host files and we do not republish descriptions; every download link points at the author’s own release.

Not indexed yet. Score 28 against a threshold of 55. The page still exists and is still linked; it simply carries noindex until we hold more.