STEAM_WORKSHOP creator
76561198379883337
54 projects across 1 game, 182.5k downloads in total.
- Projects
- 54
- Game
- 1
- Downloads
- 182.5k
- Last shipped
- 3 mo ago
- 1000 Words"The name is for the table. The actual amount is doubled." Idea - Pruz Impletentor - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.10.7k downloadsupdated 17 mo ago
- Light Bulbs"These things don't even glow!" (Re)Implementer - BigCrunch22 Recreation of the deleted module created by Devster If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.9.6k downloadsupdated 4 y ago
- Poles Of DifferenceIn this universe, everything needs to be balanced. So, I present you with this duo. I present you with the "easiest" module - The Simpleton I present you with the "hardest" module - Misery Squares Idea/Implementer - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have...9.3k downloadsupdated 2 y ago
- Five Letter Words"Rules are quite basic" Idea - Pruz Implementer - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.9.2k downloadsupdated 4 y ago
- Alphabetize"You know the alphabet, right? Well, get ready to learn it again!" (Re)Implementer - BigCrunch22 Recreation of the deleted module created by Devster If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.9.2k downloadsupdated 6 y ago
- Reverse AlphabetizeYou know the alphabet, right? Dvoo, tvg ivzwb gl ovzim rg ztzrm!" (Re)Implementer - BigCrunch22 Recreation of the deleted module created by Devster If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.9.1k downloadsupdated 6 y ago
- Guess Who?"So you're telling me, after making 100s of ridiculous module requests like a Vault, a Safe, a Sun, and a Moon... you're asking me to make Guess Who? Guess who's not making your mod? NOT ME! Because I made it into reality. Peace!" Idea - Blananas2 Implementer - BigCrunch22 If someone wants to add...9.1k downloadsupdated 4 y ago
- A Message"I’m forwarding you a message. Like, literally." Idea/Implementer - BigCrunch22 My first ever module. YAY! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.9.0k downloadsupdated 2 y ago
- Shifting Maze"I hope RNG will be nice with this one." Idea/Implementer - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have my approval for that8.9k downloadsupdated 5 y ago
- Vcrcs"Do you see what I mean?" Idea - Pruz Implementer - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.8.9k downloadsupdated 4 y ago
- RPS Judging"Deciding everytime when they fight" Idea/Implementor - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.8.9k downloadsupdated 3 mo ago
- Musical Transposition"It's Piano Keys, but more time-consuming. Have fun!?" (Re)Implementer - BigCrunch22 Recreation of the removed module created by JimIsWayTooEpic TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.4.2k downloadsupdated 5 y ago
- % Grey"But how will you relay this information in between you and the defuser?" Idea - Pruz Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.3.1k downloadsupdated 4 y ago
- Regular Sudoku"This is as basic as you can get with a puzzle" Implementer - BigCrunch22 Used a lot of assets from the module "Ultimate Tic-Tac-Toe" by Goofy/Timwi TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.6k downloadsupdated 10 mo ago
- Pickup Identification"This really is a weird treasure hunt." Idea/Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.5k downloadsupdated 2 y ago
- Switching Maze"Bad for people with certain conditions." Idea/Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that2.4k downloadsupdated 5 y ago
- Life Iteration"Solving this module is a matter of life and death, many times over!" Based on the Game of Life Simple module made by samfun123 Made and modified by BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.4k downloadsupdated 4 y ago
- Bowling"Why does bowling need to be so complicated? Just throw the ball at the pins and be over with it!" Idea - Kib the Slime Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.4k downloadsupdated 4 y ago
- Plant Identification"Basic zombie learning material. Learn what to eat." Idea/Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.4k downloadsupdated 3 y ago
- Negativity"It’s called “Negativity” but not “Positivity”? I demand opposition equality!" Idea - ktane1 Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.3k downloadsupdated 5 y ago
- Alphabet Tiles""Cheerleader" included." Idea/Implementer - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.2k downloadsupdated 5 y ago
- Audio Keypad"Instead of actually defusing the bomb, press play, and show the defusal sound clip to your cool friend Gary." Idea - tandyCake Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.2k downloadsupdated 5 y ago
- Addition"This is literally just addition. I have no idea why anybody thought that this would be fun, challenging, or interesting to put on a bomb." Idea - Panoptes (Mirage Xel) Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.2k downloadsupdated 5 y ago
- Atbash Cipher"R nvnliravw Zgyzhs! - cerulean" Idea - cerulean Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.1k downloadsupdated 3 y ago
- Bad Wording"This module is yes because defuse are will happen" Idea - Asew54321 Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.1k downloadsupdated 5 y ago
- White Arrows"How is anyone supposed to solve this module?" Idea - Pruz Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.1k downloadsupdated 4 y ago
- Baybayin Words"We don’t actually use this alphabet in our country." Idea/(Re)Implementer - BigCrunch22 The ownership of the module has been transferred to me. Unsubscribe from the older version: TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.0k downloadsupdated 5 y ago
- Going Backwards"!tsaf og attoG" Idea - TechnoTurquoise Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.0k downloadsupdated 5 y ago
- What's on Second"You know Who’s on First. But have you ever thought about the guy before him? The guy that almost won but didn’t? Well, good luck, ‘cause he’s having his revenge…" Idea - Anonymous Implementer - BigCrunch22 Used a lot of assets from the module "Third Base" by Asimir TP Supported! If someone wants...2.0k downloadsupdated 4 y ago
- Two Persuasive Buttons"Click me! Hold on a minute! Nobody loves you more than me. No way, I love you the most. Who do you choose, defuser?" Idea - Pruz Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.2.0k downloadsupdated 6 y ago
- Numerical Knight Movement"Saying that the module is horsing around is an understatement." Idea/Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 5 y ago
- Saimoe Maze"Cruelest Cruel of Cruels." Idea - Tachatat18 Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 2 y ago
- Security Council"You are on this council, but we do not grant you the rank of Permanent Member." Idea - Vincology Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 3 mo ago
- Saimoe Pad"No, there is no way to know these symbols." Idea - Tachatat18 Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 5 y ago
- Snack Attack"Experimental gameplay is in command. Also, food is in stock." Idea/Implementer - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 4 y ago
- Keypad Directionality"Am I actually going anywhere with these arrows?" Idea - DragonManiac Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 5 y ago
- DNA Mutation"GATCGATTCGATCGATGCTAGC…" Idea - Serum Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 5 y ago
- Colored Letters"Multicolored multialphabet multibutton." Idea - Pruz Original Implementer - Panoptes Current Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 4 y ago
- Hole in One"Why are sports becoming modules now?" (Re)Implementer - BigCrunch22 Recreation of the removed module created by Finder TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 3 y ago
- The Close Button"Popup ads have stepped up their game. Bring it on" Idea/Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 5 y ago
- Pixel Number Base"No. Just no." Idea/(Re)Implementer - BigCrunch22 The ownership of the module has been transferred to me. Unsubscribe from the older version: TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 6 y ago
- Floor Lights"Similar to a certain needy, but this one will kill you if you take the spotlight incorrectly." Idea/Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.7k downloadsupdated 4 y ago
- The Sequencyclopedia"The only thing worse than an encyclopedia? One on a bomb." Idea - EpicToast Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.7k downloadsupdated 2 y ago
- Wild Side"And that’s called jazz!" Idea - Pruz Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.7k downloadsupdated 4 y ago
- SpriteClub Betting Simulation (BETA)"There could only be one winner. Root for your champion" Idea/Implementer - BigCrunch22 NOTE: This module is not intended for regular gameplay. Internet connection is also needed for the module. Adding TP support might not be necessary for this module. Issues with the module ATM (that I know): -S...1.5k downloadsupdated 3 y ago
- Memory Character"Call ‘em like you see ‘em." Idea/Implementer - Null TP Supported If someone wants to add TP Support/Logging/Anything useful, you have my approval for that1.4k downloadsupdated 4 y ago
- The Number Game + The Mini Game"Crunching numbers against an opponent that is impossible to beat." - The Number Game "The machine might be smaller in scope than the other one, but it makes up for it in massive loss of time." - The Mini Game Idea/Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging...1.2k downloadsupdated 3 y ago
- Tether & Torment"I have tried to leave, but they still will not let me go." - ??? ¿¿¿ - ,,˙pᴉp noʎ ʇɐɥʍ ɹoɟ noʎ ǝʌᴉƃɹoɟ ɹǝʌǝu llᴉʍ I,, Idea/Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.2k downloadsupdated 3 y ago