ModsKeep Talking and Nobody Explodes
Keep Talking and Nobody Explodes mods
A mod changes the game itself. It needs something to load it, it may need other mods first, and it only works on the versions its author built it for.
2,654 mods, most downloaded first · newest update 29 Oct 2026
- Navinumsby TimwiThis is a re-upload of Goofy’s original module with bugfixes and improvements. Please UNSUBSCRIBE from the old version. Press the correct digits and keep track of the directions. Module idea by Pruz, implemented by Goofy, maintained by Timwi.1.9k downloadsupdated 5 y ago
- RGB Logicby SpeakingevilThe colors, Duke! The colors! Apply a boolean operator to two grids of RGB colours Created by Speakingevil1.9k downloadsupdated 5 y ago
- Aquariumby TimwiIf there is magic on this planet, it is contained in water. Module created by JakkOfKlubs & Timwi. Manual PDF Manual HTML1.9k downloadsupdated 2 y ago
- int##by 76561199013569552Whoops! Dropped the manual while getting this to you, so I guess you'll have to figure it out yourselves! Module ID: int##1.9k downloadsupdated 5 y ago
- Saimoe Mazeby 76561198379883337"Cruelest Cruel of Cruels." Idea - Tachatat18 Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 3 y ago
- D-CIPHERby asreissTHE MOTHERSHIP DFEMANDS YOUR ATTENTION. Regular module by Mirage Xel. Module ID: xelDcipher1.9k downloadsupdated 4 y ago
- osu! [REUPLOAD]by 76561198331082758Submit the correct background image of an osu! beatmap. Original by Limeboy Maintained and updated by Eltrick Bugfixes and map additions will now go through me, either at request or whenever I feel like doing so. Please unsubscribe from the old version.1.9k downloadsupdated 5 y ago
- Semabolsby asreissI'm not sure what these symbols are, but I'm pretty sure they have something to do with maritime flags. Semabols regular module by PANOPTES. Huge thanks to Obvious for designing the symbols used in the module and for help with the code. TP Supported!1.9k downloadsupdated 5 y ago
- Accelerandoby TimwiThis is a re-upload of Goofy’s module. Please unsubscribe from the old version. Keep track of an accelerating sequence of number-letter pairs and press the correct letters. Includes rule-seed support and TP support.1.9k downloadsupdated 13 mo ago
- Security Councilby 76561198379883337"You are on this council, but we do not grant you the rank of Permanent Member." Idea - Vincology Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 5 mo ago
- Burnoutby xXTheDweebXxBurnout v1.9 “I’ll be honest with you, this thing is a real crash breaker!" Module Idea by: Wolfy78 Implemented by: Kat(arina) Module Id: kataBurnout TP-Supported. HTML Manual Version: If there are any problems that you may have, contact me via Discord: Smexy Ahri#52591.9k downloadsupdated 4 y ago
- Forget's Ultimate Showdownby RFK Jr's Brain wormNo, this is not a boss module. Stop being judgeme... Oh wait that's already taken. Assets used from modules by: Speakingevil, Espik, Hexicube, Royal_Flu$h, VFlyer, Short_c1rcuit, Rdzanu, Pruz, MarioXTurn and Epictho. Thanks to Xarata for playtesting. Twitch plays is supported. Manual: PDF: HTML:...1.9k downloadsupdated 4 y ago
- NeeDeez Nutsby Fartlicker777I have given up on life1.9k downloadsupdated 4 y ago
- Richard Osman's House Of Games Modulesby asreissThis is a module pack based on the British quiz show Richard Osman's House Of Games (Currently just Broken Karaoke). Module IDs: xelBrokenKaraoke TP Supported.1.9k downloadsupdated 6 y ago
- XmORse Codeby 76561198889068075XmORse Code This would be easier to solve if these flashes made actual letters Module ID: xmorse Created by Short_c1rcuit Has TP support Manual available here: Build 1.0 notes: Initial release Build 1.1 notes: Fixed VR Eyebug1.9k downloadsupdated 2 y ago
- Saimoe Padby 76561198379883337"No, there is no way to know these symbols." Idea - Tachatat18 Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 6 y ago
- Numpathby tandyCakeThe one thing about computer numpads is that the numbers are never quite where you think they’d be. Move through a 3×3 grid and navigate to every number in the serial number. Module by tandyCake moduleID: numpath Manual can be found on ktane.timwi.de1.9k downloadsupdated 5 y ago
- Simon Supportsby tandyCakeLast meeting we brought up the lack of color within the office. Now the office looks like a Christmas lights factory. Module by tandyCake and Blananas2 Module ID: simonSupports Manual can be found on ktane.timwi.de1.9k downloadsupdated 3 y ago
- Sporadic Segmentsby asreissThis appears to be a cross between a GameBoy and a digital clock, except the GameBoy only has one game, and the clock... Sporadic Segments module by PANOPTES version 1.00. Font is Clandesdyne Pixelated Digital Clock, by Clandesdyne. Module ID: xelSporadicSegments Github Repo:1.9k downloadsupdated 5 y ago
- Hold Onby 76561198928399095Using edgework, find the number of seconds the on button must be held for. Module ID: ashHoldOn1.9k downloadsupdated 5 y ago
- Colored Hexabuttonsby SeanGithub: Temp Manual: A return to classic mechanics in my opinion makes the game for what it is today. Manual Idea and Module Implementation: Sean Obach1.9k downloadsupdated 2 y ago
- The Logan Parody Jukeboxby 76561198419068972Logan (aka "wow its a person") sings his own parodies some of your favorite songs in this spin-off of The Jukebox!1.9k downloadsupdated 5 y ago
- Sysadminby NickLatkovichA module in which you need to administer the network through the console.1.9k downloadsupdated 5 y ago
- 100 Levels of Defusal Missionsby 76561198335630961This mission pack contains 100 missions, in which every module in the game can be found in here (up to 6/1/2020). Try to beat them all! Originally bundled with the 100 Levels of Defusal module but now separated into its own mod.1.9k downloadsupdated 5 y ago
- Simon Swindlesby 76561199013569552Kick player: Simon (Cheating) Press F1 to vote YES Press F2 to vote NO Vote Count: YES-8 NO-1 Module ID: simonSwindles Manual can be found at:1.9k downloadsupdated 4 y ago
- Cursor Mazeby eXishNavigate your cursor through a simple maze without touching the walls. This module requires a mouse to be solved. HTML: PDF: Cursor Maze (cursorMazeModule) v1.0.4 Module and Concept by eXish Twitch Plays supported1.9k downloadsupdated 3 y ago
- GoodHood's Modulesby 76561198343303283All four of GoodHood's now-deleted modules, reuploaded (technically). Includes: Press The Shape Standard Button Masher Button Order Binary Buttons1.9k downloadsupdated 5 y ago
- Cruel Starsby CyberA less forgiving version of stars, play with caution. Manual:1.9k downloadsupdated 6 y ago
- Icon Revealby 76561198419068972Figure out what the icon is and its periodic table symbol! (Note: The icon does not actually get "revealed" over time, it's just static.) This module may encounter frequent bugs so please contact me with a logfile if this occurs.1.9k downloadsupdated 6 y ago
- Cruelloby SpeakingevilCruello ver 1.0 Easy as... ...it's not easy. Toggle the buttons in the grid such that the numbers in each row and column add up to the desired values and their colours follow certain rules. Created by Speakingevil1.9k downloadsupdated 6 y ago
- Next In Lineby Fartlicker777Unlike elementary school, cutting in line is allowed. Cut a wire based on the previously cut wire. Module design by eXish. Manual can be found at ktane.timwi.de If there are any bugs, contact Fartlicker777 on Discord.1.9k downloadsupdated 5 y ago
- RGB Hypermazeby okPerform rotations on a 4D maze generated by boolean operations.1.9k downloadsupdated 3 y ago
- Snack Attackby 76561198379883337"Experimental gameplay is in command. Also, food is in stock." Idea/Implementer - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 4 y ago
- Keypad Directionalityby 76561198379883337"Am I actually going anywhere with these arrows?" Idea - DragonManiac Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 6 y ago
- Flyswattingby 76561198443052403Damn. I thought humanity was getting better but now they decided to put the most annoying activity that has ever existed on this Earth on a $%^&ing bomb... Module ID: flyswatting The manual can be found here:1.9k downloadsupdated 2 y ago
- Supermassive Black Holeby NickLatkovichThrow a sequence of base-36 digits into a supermassive black hole based on its accretion disk. Supermassive Black Hole has integration with regular Black Hole. Rule Seed: Supported (code synced with rule seed of regular Black Hole); Twitch Plays: Supported1.9k downloadsupdated 1 mo ago
- Red Herring (REUPLOAD)by tandyCakeRed Herring: Noun, something to distract you from the task at hand. Module originally by Deaf Reuploaded and reworked by tandyCake moduleID: RedHerring Manual can be found at ktane.timwi.de1.9k downloadsupdated 5 y ago
- Colored Lettersby 76561198379883337"Multicolored multialphabet multibutton." Idea - Pruz Original Implementer - Panoptes Current Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 5 y ago
- DNA Mutationby 76561198379883337"GATCGATTCGATCGATGCTAGC…" Idea - Serum Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 5 y ago
- Drive-In Windowby Grenade JumperI'll have a burger, a shake, and a live bomb, please. My first module, inspired by seeing in chat one day, as well as this being my favorite esolang. Direct any bug reports or suggestions to Norville Rogers#1633 on Discord. As this is my first mod, any feedback is nice. Has TP Support.1.9k downloadsupdated 3 y ago
- Stacked Sequencesby 76561198873224404ere do I start? Where do I start? Where do I start? Where do I sta A collaboration with GhostSalt#0217 on Discord where we reversed roles compared to The Xenocryst.1.8k downloadsupdated 6 y ago
- Frankenstein's Indicatorby 76561198443052403THE INDICATOR IS ALIVE!!! Bad news: It morphed into a module. Module ID: frankensteinsIndicator The manual can be found here:1.8k downloadsupdated 3 y ago
- Stable Time Signaturesby Fartlicker777A practice variant of Time Signatures that doesn't reset upon listening to it again! Original module by KingBranBran which can be found at Also thanks to KingBranBran for allowing me to do this. If you want to set how many time signatures to do in a mission, put the following in the description:...1.8k downloadsupdated 22 mo ago
- Module Assembly Stationby RFK Jr's Brain wormWelcome to the Module Assembly Station INC. This room supports 2 bombs.1.8k downloadsupdated 9 y ago
- Literally Nothingby 76561198362753199It's literally nothing... Mod ID: literallyNothing Manuals: ktane.timwi.de/HTML/Literally%20Nothing.html ktane.timwi.de/PDF/Literally%20Nothing.pdf1.8k downloadsupdated 6 y ago
- Birthdaysby TasThilunaWho knew Lil Tecca and Mother Teresa had something in common? Module idea by Nico Robin, implementation by TasThiluna. Manual HTML Manual PDF1.8k downloadsupdated 5 y ago
- Space Invaders Extremeby 76561198819581302Of all things, why is this a module? My first needy module. May be slow on some low-end devices. (sorry for your loss) No TP support. (jk there's TP support get jebaited)1.8k downloadsupdated 3 y ago
- Iñupiaq Numeralsby 76561198443052403If you’re complaining about the fact that this has an ñ in it’s name, just be glad it’s not an ŋ, nobody knows how to pronounce that. Module ID: inupiaqNumerals The manual can be found here:1.8k downloadsupdated 9 mo ago
2.7k mods, most downloaded first. Each one has its own page here with what it needs to run and where its author publishes it; the files themselves stay with the author and are never re-hosted on this site.