Keep Talking and Nobody Explodes
Keep Talking and Nobody Explodes mods
A mod changes the game itself, so it is tied to a game version and to whatever loads it. Filter by both and you get the list that will actually load, not the list that mentions your version somewhere in a description.
- RGB Logicby SpeakingevilThe colors, Duke! The colors! Apply a boolean operator to two grids of RGB colours Created by Speakingevil1.9k downloadsupdated 5 y ago
- Security Councilby 76561198379883337"You are on this council, but we do not grant you the rank of Permanent Member." Idea - Vincology Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 3 mo ago
- D-CIPHERby asreissTHE MOTHERSHIP DFEMANDS YOUR ATTENTION. Regular module by Mirage Xel. Module ID: xelDcipher1.9k downloadsupdated 4 y ago
- int##by 76561199013569552Whoops! Dropped the manual while getting this to you, so I guess you'll have to figure it out yourselves! Module ID: int##1.9k downloadsupdated 5 y ago
- Semabolsby asreissI'm not sure what these symbols are, but I'm pretty sure they have something to do with maritime flags. Semabols regular module by PANOPTES. Huge thanks to Obvious for designing the symbols used in the module and for help with the code. TP Supported!1.9k downloadsupdated 5 y ago
- Burnoutby xXTheDweebXxBurnout v1.9 “I’ll be honest with you, this thing is a real crash breaker!" Module Idea by: Wolfy78 Implemented by: Kat(arina) Module Id: kataBurnout TP-Supported. HTML Manual Version: If there are any problems that you may have, contact me via Discord: Smexy Ahri#52591.9k downloadsupdated 4 y ago
- XmORse Codeby 76561198889068075XmORse Code This would be easier to solve if these flashes made actual letters Module ID: xmorse Created by Short_c1rcuit Has TP support Manual available here: Build 1.0 notes: Initial release Build 1.1 notes: Fixed VR Eyebug1.9k downloadsupdated 22 mo ago
- Ten-Button Color Codeby TimwiThis is a re-upload of KingSlendy’s module. Please unsubscribe from the old version. Who would've thought that only 3 colors would be such a problem Made by: KingSlendy Original idea by: Lumbud84 moduleID: TenButtonColorCode Manual HTML: Manual PDF:1.9k downloadsupdated 5 y ago
- Richard Osman's House Of Games Modulesby asreissThis is a module pack based on the British quiz show Richard Osman's House Of Games (Currently just Broken Karaoke). Module IDs: xelBrokenKaraoke TP Supported.1.9k downloadsupdated 6 y ago
- osu! [REUPLOAD]by 76561198331082758Submit the correct background image of an osu! beatmap. Original by Limeboy Maintained and updated by Eltrick Bugfixes and map additions will now go through me, either at request or whenever I feel like doing so. Please unsubscribe from the old version.1.9k downloadsupdated 5 y ago
- Cruel Starsby CyberA less forgiving version of stars, play with caution. Manual:1.9k downloadsupdated 6 y ago
- Numpathby tandyCakeThe one thing about computer numpads is that the numbers are never quite where you think they’d be. Move through a 3×3 grid and navigate to every number in the serial number. Module by tandyCake moduleID: numpath Manual can be found on ktane.timwi.de1.9k downloadsupdated 5 y ago
- Forget's Ultimate Showdownby RFK Jr's Brain wormNo, this is not a boss module. Stop being judgeme... Oh wait that's already taken. Created and impelemented by: Marksam32 With assets used from modules by: Speakingevil, Espik, Hexicube, Royal_Flu$h, VFlyer, Short_c1rcuit, Rdzanu, Pruz, MarioXTurn and Epictho. Thanks to Xarata for playtesting. Tw...1.9k downloadsupdated 4 y ago
- Saimoe Padby 76561198379883337"No, there is no way to know these symbols." Idea - Tachatat18 Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.9k downloadsupdated 5 y ago
- Aquariumby TimwiIf there is magic on this planet, it is contained in water. Module created by JakkOfKlubs & Timwi. Manual PDF Manual HTML1.9k downloadsupdated 23 mo ago
- NeeDeez Nutsby Fartlicker777I have given up on life1.9k downloadsupdated 4 y ago
- Simon Supportsby tandyCakeLast meeting we brought up the lack of color within the office. Now the office looks like a Christmas lights factory. Module by tandyCake and Blananas2 Module ID: simonSupports Manual can be found on ktane.timwi.de1.9k downloadsupdated 3 y ago
- Sporadic Segmentsby asreissThis appears to be a cross between a GameBoy and a digital clock, except the GameBoy only has one game, and the clock... Sporadic Segments module by PANOPTES version 1.00. Font is Clandesdyne Pixelated Digital Clock, by Clandesdyne. Module ID: xelSporadicSegments Github Repo:1.9k downloadsupdated 4 y ago
- 100 Levels of Defusal Missionsby 76561198335630961This mission pack contains 100 missions, in which every module in the game can be found in here (up to 6/1/2020). Try to beat them all! Originally bundled with the 100 Levels of Defusal module but now separated into its own mod.1.9k downloadsupdated 5 y ago
- Accelerandoby TimwiThis is a re-upload of Goofy’s module. Please unsubscribe from the old version. Keep track of an accelerating sequence of number-letter pairs and press the correct letters. Includes rule-seed support and TP support.1.9k downloadsupdated 11 mo ago
- Hold Onby 76561198928399095Using edgework, find the number of seconds the on button must be held for. Module ID: ashHoldOn1.9k downloadsupdated 5 y ago
- The Logan Parody Jukeboxby 76561198419068972Logan (aka "wow its a person") sings his own parodies some of your favorite songs in this spin-off of The Jukebox!1.8k downloadsupdated 5 y ago
- Colored Hexabuttonsby SeanGithub: Temp Manual: A return to classic mechanics in my opinion makes the game for what it is today. Manual Idea and Module Implementation: Sean Obach1.8k downloadsupdated 2 y ago
- Sysadminby NickLatkovichA module in which you need to administer the network through the console.1.8k downloadsupdated 5 y ago
- Module Assembly Stationby RFK Jr's Brain wormWelcome to the Module Assembly Station INC. This room supports 2 bombs. Created by: Marksam321.8k downloadsupdated 9 y ago
- Simon Swindlesby 76561199013569552Kick player: Simon (Cheating) Press F1 to vote YES Press F2 to vote NO Vote Count: YES-8 NO-1 Module ID: simonSwindles Manual can be found at:1.8k downloadsupdated 4 y ago
- Cruelloby SpeakingevilCruello ver 1.0 Easy as... ...it's not easy. Toggle the buttons in the grid such that the numbers in each row and column add up to the desired values and their colours follow certain rules. Created by Speakingevil1.8k downloadsupdated 6 y ago
- Snack Attackby 76561198379883337"Experimental gameplay is in command. Also, food is in stock." Idea/Implementer - BigCrunch22 If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 4 y ago
- Next In Lineby Fartlicker777Unlike elementary school, cutting in line is allowed. Cut a wire based on the previously cut wire. Module design by eXish. Manual can be found at ktane.timwi.de If there are any bugs, contact Fartlicker777 on Discord.1.8k downloadsupdated 5 y ago
- RGB Hypermazeby okPerform rotations on a 4D maze generated by boolean operations.1.8k downloadsupdated 3 y ago
- Icon Revealby 76561198419068972Figure out what the icon is and its periodic table symbol! (Note: The icon does not actually get "revealed" over time, it's just static.) This module may encounter frequent bugs so please contact me with a logfile if this occurs.1.8k downloadsupdated 6 y ago
- Cursor Mazeby eXishNavigate your cursor through a simple maze without touching the walls. This module requires a mouse to be solved. HTML: PDF: Cursor Maze (cursorMazeModule) v1.0.4 Module and Concept by eXish Twitch Plays supported1.8k downloadsupdated 3 y ago
- Keypad Directionalityby 76561198379883337"Am I actually going anywhere with these arrows?" Idea - DragonManiac Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 5 y ago
- Flyswattingby 76561198443052403Damn. I thought humanity was getting better but now they decided to put the most annoying activity that has ever existed on this Earth on a $%^&ing bomb... Module ID: flyswatting The manual can be found here:1.8k downloadsupdated 2 y ago
- Red Herring (REUPLOAD)by tandyCakeRed Herring: Noun, something to distract you from the task at hand. Module originally by Deaf Reuploaded and reworked by tandyCake moduleID: RedHerring Manual can be found at ktane.timwi.de1.8k downloadsupdated 5 y ago
- Stacked Sequencesby 76561198873224404ere do I start? Where do I start? Where do I start? Where do I sta A collaboration with GhostSalt#0217 on Discord where we reversed roles compared to The Xenocryst.1.8k downloadsupdated 6 y ago
- GoodHood's Modulesby 76561198343303283All four of GoodHood's now-deleted modules, reuploaded (technically). Includes: Press The Shape Standard Button Masher Button Order Binary Buttons1.8k downloadsupdated 5 y ago
- Drive-In Windowby Grenade JumperI'll have a burger, a shake, and a live bomb, please. My first module, inspired by seeing in chat one day, as well as this being my favorite esolang. Direct any bug reports or suggestions to Norville Rogers#1633 on Discord. As this is my first mod, any feedback is nice. Has TP Support.1.8k downloadsupdated 3 y ago
- DNA Mutationby 76561198379883337"GATCGATTCGATCGATGCTAGC…" Idea - Serum Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 5 y ago
- Colored Lettersby 76561198379883337"Multicolored multialphabet multibutton." Idea - Pruz Original Implementer - Panoptes Current Implementer - BigCrunch22 TP Supported! If someone wants to add TP Support/Logging/Anything useful, you have my approval for that.1.8k downloadsupdated 4 y ago
- Supermassive Black Holeby NickLatkovichThrow a sequence of base-36 digits into a supermassive black hole based on its accretion disk. Supermassive Black Hole has integration with regular Black Hole. Rule Seed: Supported (code synced with rule seed of regular Black Hole); Twitch Plays: Supported1.8k downloadsupdated 5 y ago
- Frankenstein's Indicatorby 76561198443052403THE INDICATOR IS ALIVE!!! Bad news: It morphed into a module. Module ID: frankensteinsIndicator The manual can be found here:1.8k downloadsupdated 3 y ago
- Stable Time Signaturesby Fartlicker777A practice variant of Time Signatures that doesn't reset upon listening to it again! Original module by KingBranBran which can be found at Also thanks to KingBranBran for allowing me to do this. If you want to set how many time signatures to do in a mission, put the following in the description:...1.8k downloadsupdated 21 mo ago
- Literally Nothingby 76561198362753199It's literally nothing... Mod ID: literallyNothing Manuals: ktane.timwi.de/HTML/Literally%20Nothing.html ktane.timwi.de/PDF/Literally%20Nothing.pdf1.8k downloadsupdated 6 y ago
- Space Invaders Extremeby 76561198819581302Of all things, why is this a module? My first needy module. May be slow on some low-end devices. (sorry for your loss) No TP support. (jk there's TP support get jebaited)1.8k downloadsupdated 3 y ago
- 中文汉化版炸弹拆除指南 Manual - Chinese Translationby 𝓟𝖔𝖕𝖊𝖘𝖙Chinese translation of the game manual. Get this if you want color for your manual. Unfortunately, the colored version is created by me based on my translated version, so there won't be an English version. I included all 4 versions of Translated Manual (For the translated and for the vanilla modu...1.8k downloadsupdated 9 y ago
- Iñupiaq Numeralsby 76561198443052403If you’re complaining about the fact that this has an ñ in it’s name, just be glad it’s not an ŋ, nobody knows how to pronounce that. Module ID: inupiaqNumerals The manual can be found here:1.8k downloadsupdated 8 mo ago
- Birthdaysby TasThilunaWho knew Lil Tecca and Mother Teresa had something in common? Module idea by Nico Robin, implementation by TasThiluna. Manual HTML Manual PDF1.8k downloadsupdated 5 y ago

